Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

YASARA Repository


Here you can find YASARA macros and plugins to solve your problems, as well as interactive movies that show you how things work in theory and practice. If a topic is new to you, YASARA movies allow you to quickly 'absorb' the required knowledge and are therefore a well suited supplement for teaching. They can be viewed with any stage of YASARA.

Remember that all stages of YASARA can become free if you contribute, so submit your own developments from the contact page and get listed here!


° 

Browse by Topic

Select your topic of interest:

° 

General

° 

Molecular graphics

° 

Molecular dynamics

° 

Molecular modeling

° 

Structure determination

° 

Structure prediction

° 

Database interfaces

° 

Research topics

° 

Multimedia


° 

Browse by Type

Select the type of add-on you are looking for:

° 

Movies

° 

Plugins

° 

Macros