Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 


Download Center

What do you want to download?

YASARA for new users

If you have not used YASARA before, click here to register and obtain YASARA. Also click here if you want to upgrade to a higher YASARA stage.


YASARA for registered users

If you have already used YASARA before, click here to download YASARA again or update to version 24.4.10. If you want to know what is new, visit the changelog.


YASARA Movies, Plugins, Macros

If you are looking for multimedia presentations or have a problem to solve, visit the YASARA repository. Someone else may already have provided the solution. Click here to access the repository.


Models@Home

If you want to get a cluster for free, install the Models@Home screensaver and run your programs in parallel.


Structural Bioinformatics Tools

If you are working in structural bioinformatics, look at our collection of useful programs that will make your life easier. Licensed under the GNU GPL.