Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Superpositions and alignments in YASARA

Superposition and alignment

In addition to a classical superposition that minimizes the RMSD between two atom selections, YASARA supports a number of special features:

  • Chemically equivalent atoms can be flipped automatically to minimize the RMSD. For example when calculating the heavy-atom RMSD between two proteins, it may happen that a certain Phe side-chain has been flipped by 180 degrees, i.e. the CD1/CE1 atoms have swapped place with CD2/CE2. Chemically the result is identical, yet a wrong RMSD will be calculated if the atoms are not flipped back. YASARA supports this flipping for all kinds of molecules by analyzing the structure to search for equivalent atoms to flip.
  • Simultaneous superposition of multiple objects on their core regions. When calculating an NMR structure, it is usually needed to superpose the resulting bundle of structures all together, putting most emphasis on the core regions, so that the superposition is not negatively influenced by floppy tails. To achieve this goal, YASARA features the THESEUS maximum likelihood method[1].
  • Structural alignments. If it is not known which atoms should actually be superposed, one needs to create an alignment first. When working with proteins, the most successful approach is to ignore the sequence and concentrate on the structure only. This allows to superpose also distantly related proteins with high accuracy. A large number structural alignment programs have been developed. YASARA has a built-in MUSTANG module[2] a local plugin for SHEBA[3] in Linux and MacOSX, and a web server interface to SHEBA, CE[4] and Multiprot[5] provided by Mikael Roche & Emmanuel Bettler.
  • Multiple structural alignments. If the goal is to align and superpose an entire protein family, the required multiple structural alignment can be performed with the built-in MUSTANG module[2].
  • Sequence alignments. In some rare applications, one needs to superpose proteins based on a sequence alignment. YASARA supports local Smith&Waterman and global Needleman&Wunsch sequence alignments to achieve this goal.

R E F E R E N C E S

[1] THESEUS: maximum likelihood superpositioning and analysis of macromolecular structures
Theobald DL, Wuttke DS (2006) Bioinformatics 22 ,2171-2172
[2] MUSTANG: A multiple structural alignment algorithm
Konagurthu AS, Whisstock JC, Stuckey PJ, Lesk AM (2006) Proteins 64,559-574
[3] J.Jung & B.Lee, (2000) Protein Eng. 13,535-543
[4] I.N.Shindyalov & P.E.Bourne (1998) Protein Eng. 11,739-747
[5] M.Shatsky,R.Nussinov & H.J.Wolfson (2002) Lect.Notes in Comp.Sci. 2452,235-250