Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Electrostatic potentials and solvation energies in YASARA


YASARA provides various ways to visualize electrostatic potentials (ESPs) and calculate solvation energies. They are based on two very different approaches:

  •  The Particle Mesh Ewald approach (PME) uses the reciprocal space part of Ewald summation to obtain the smoothed electrostatic potential in vacuo, without singularities and short-range noise[1]. The left column of figure 1 shows the resulting long-ranged PME potentials around the enzyme SOD (superoxide dismutase), where an electropositive channel (shown in blue) leads to the active site to help capture the superoxide anions.
  • The Poisson-Boltzmann approach (PBS) uses a customized version of the APBS program[2] to solve the Poisson-Boltzmann equation, yielding the electrostatic potential with implicit solvent and counter ions. Compared to PME, the PBS potential shows more short-range details (right column in figure 1).
Each of the two electrostatic potential types can be visualized in a number of different ways:
  • The styles Density and Points (first two rows in figure 1) visualize the ESP at each point on a grid, using either transparent or opaque dots.
  • The Contour style consists of two surfaces, first a contour of the regions with a certain negative potential (red), and second a contour of the regions with a certain positive potential (blue).
  • The Surface style is the most common one, it simply colors a surface of the protein as a function of the ESP at each surface point. Van der Waals, molecular or solvent accessible surfaces can be chosen.
Finally, solvation energies can be calculated in three different ways:
  • A very fast empirical approximation (fraction of a second).
  • A fast PME-based boundary element approach (one second).
  • A slow PBS-based calculation with APBS[2] (many seconds).

R E F E R E N C E S

[1] Fast empirical pKa prediction by Ewald summation
Krieger E, Nielsen JE, Spronk CA, Vriend G (2006) J.Mol.Graph.Model. 25,481-486
[2] Electrostatics of nanosystems: application to microtubules and the ribosome
Baker NA, Sept D, Joseph S, Holst MJ, McCammon JA (2001) Proc.Natl.Acad.Sci.USA 98, 10037-10041
Visualization of electrostatic potentials

Figure 1: The electrostatic potential around superoxide dismutase, visualized using various calculation methods and graphics styles.

Figure 2 : Screen recording of YASARA's interactive electrostatics tutorial. A higher quality version can be watched at YouTube , click on 'Watch in high quality' below the video. Since YASARA creates these animations in real-time using OpenGL, simply download the corresponding macro (GNU GPL licensed) from the YASARA movie page to watch it in highest resolution with up to 60 frames per second.